circad | circRNAs associated with diseases

Circular RNA YAP1
Gene	YAP1	Organism	Human
Genome Locus		Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink		PMID	30336780
Experimental Method
Sample Type	Tissue and cell lines	Comparison	A human tissue microarray of 80 paired GC patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACAGATGCGACTGCAGCAAC Reverse TGGGTCTAGCCAAGAGGTGG	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Liu, H, Liu, Y, Bian, Z, Zhang, J, Zhang, R, Chen, X, Huang, Y, Wang, Y, Zhu, J (2018). Circular RNA YAP1 inhibits the proliferation and invasion of gastric cancer cells by regulating the miR-367-5p/p27 Kip1 axis. Mol. Cancer, 17, 1:151.